Traditional Cloning

Back

1) Order primers to amplify your vector with restriction sites. For example:

pRS306F1cut2
clamp BamHI Gene sequence5' AAAAAA GGATCC agtttatcattatcaatactcgccatttca 3'
pRS306R3cut2 (Reverse primer is reverse complement of forward sequence)
clamp EcoRI Reverse Complement of 3' end of Gene sequence5' AAAAAA GAATTC TTAGGATTCGATTCACATTCATCTTTTTTTA 3'
Certain restriction sites need a minimal # of bp on the edges of the site as a clamp to properly cut. To be safe, use 6 bp. The minimum number of bp is listed here.
2) Optional if you are building a large fragment from several pieces: PCR up your fragments with standard PCR (see the standard Phusion Hot Start page). Design your SOE primers so that they have a minimum of 20 bp overlaps. Stitch together your pieces using SOE. In the SOE reaction, add 50 ng of each piece in the final construct.
Amplification reaction:x uL to 50 uL total10 uL phusion HF buffer1 uL 10 mM dNTPs2 uL combo primers @ 25 uM (for combo primers add 75 uL water and 12.5 uL of each primer at 100 uM)x uL template (50 ng of each piece in the final construct)0.5 uL Hot start phusion50 uL total

PCR Cycling Program
1. 98C 30s
2. 98C 5s
3. Annealing Tm + 3C of lowest Tm primer (should be in the range of 60-72C, if higher than 72C, just omit the annealing step and do a 2 step cycle alternating between 98C and 72C), 15s
3. If you are having trouble with the annealing temp, try 60-70C gradient with 3-6 samples.
4. 72C (15-30s extension/1kb, optimally use 25s/1kb, for a plasmid, this should be around 2 minutes)
5. Repeat from step 2 30 cycles
6. 72C 10 min
7. 4C hold

3) Clean up PCR product with Qiagen PCR cleanup kit. This is essential. Elute with 30 uL dH2O. Nanodrop the eluted PCR product to get the concentration for step 4. 

4) Digest 1 ug of vector and as much PCR product as you can with the FastDigest enzymes. 

Vector from miniprep:
x uL H2O to 20 uL total
2 uL 10x Fast Digest Buffer
x uL plasmid DNA up to 1 ug
1 uL Fast digest enzyme EcoRI or other enzyme
1 uL Fast digest enzyme BamH1 or other enzyme
20 uL total

PCR cleaned product:

x uL H2O to 20 uL total
2 uL 10x Fast Digest Buffer
x uL PCR cleaned product up to 1 ug
1 uL Fast digest enzyme EcoRI or other enzyme
1 uL Fast digest enzyme BamH1 or other enzyme
20 uL total

5) Digest in PCR machine at 37C for 5 minutes, hold at 4C. For the vector, add 1 uL of CIP and incubate at 37C for an additional 15 minutes (crucial step!).

6) Run a gel of uncut vector, double digested/CIPed vector, uncut insert, dd insert. For the dd vector, load all of the sample so you can gel extract it. You may want to do this for the dd insert as well, but if you know that the vector or insert amplify or cut cleanly, then you can just run out about 2 uL. 

7) Gel purify the appropriate fragment and elute with 30 uL. If you only ran out 2 uL of sample, PCR cleanup instead eluting with 30 uL. 

8) Nanodrop your samples for a concentration. 

9) Use the following formula to determine how much insert to use for a 1:1 molar ratio.
[(Xbp vector)/(X bp insert)] = [(50 ng vector)/(X nb insert)]

If you have a smaller insert, use a 1:3 ratio. If your insert is large change the ratio so that it is closer to 1:1. For example, if your vector is 4,373 bp and your insert is 3,135 bp, consider doing both a 1:1 and 1:2 ratio. 

10) For ligation:
2 uL T4 ligase buffer
x uL CIP treated dd vector for 50 ng
x ul dd insert for a 1:1, 1:2, or 1:3 ratio with vector
x uL dH2O to 20 uL
20 uL total

Incubate o/n at 16C

11) Transform into chemically competent Top10s:
Combine 2 uL DNA with 50 uL TOP10s chem competent cells. Let sit 30 minutes on ice. Heat shock at 42C for 30 seconds. Put on ice 2 minutes. Add 1 mL LB, shake 37C for 1 hr. Spin down cells at 5 kg for 1 minute. Remove LB until there is only about 150-200 uL left. Resuspend cells and plate the entire mixture.